Mouse sialate O-acetylesterase Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:HGH044-NY

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1626bp
Gene Synonym
LSE, Ysg2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse sialic acid acetylesterase Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Sialate O-acetylesterase belongs to the family of hydrolases, specifically those acting on carboxylic ester bonds. It is widely expressed with high expression in the testis, prostate, and colon. The systematic name of this enzyme class is N-acyl-O-acetylneuraminate O-acetylhydrolase. Other names in common use include N-acetylneuraminate acetyltransferase, sialate 9(4)-O-acetylesterase, and sialidase. Sialate O-acetylesterase catalyzes the removal of O-acetyl ester groups from position 9 of the parent sialic acid, N-acetylneuraminic acid. Defects in Sialate O-acetylesterase are a cause of autoimmune disease type 6 (AIS6). Individuals manifesting susceptibility to autoimmune disease type 6 can suffer from juvenile idiopathic arthritis, rheumatoid arthritis, multiple sclerosis, Sjogren syndrome, systemic lupus erythematosus, type 1 diabetes, ulcerative colitis, and Crohn disease.
References
  • Mandal C, et al. (2012) Regulation of O-acetylation of sialic acids by sialate-O-acetyltransferase and sialate-O-acetylesterase activities in childhood acute lymphoblastic leukemia. Glycobiology. 22(1): 70-83.
  • Tsai S, et al. (2011) Transcriptional profiling of human placentas from pregnancies complicated by preeclampsia reveals disregulation of sialic acid acetylesterase and immune signalling pathways. Placenta. 32 (2): 175-82.
  • Surolia I, et al. (2010) Functionally defective germline variants of sialic acid acetylesterase in autoimmunity. Nature. 466 (7303): 243-7.
  • TOP