Mouse sialate O-acetylesterase Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:HGH044-NO

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1626bp
Gene Synonym
LSE, Ysg2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse sialic acid acetylesterase Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Sialate O-acetylesterase belongs to the family of hydrolases, specifically those acting on carboxylic ester bonds. It is widely expressed with high expression in the testis, prostate, and colon. The systematic name of this enzyme class is N-acyl-O-acetylneuraminate O-acetylhydrolase. Other names in common use include N-acetylneuraminate acetyltransferase, sialate 9(4)-O-acetylesterase, and sialidase. Sialate O-acetylesterase catalyzes the removal of O-acetyl ester groups from position 9 of the parent sialic acid, N-acetylneuraminic acid. Defects in Sialate O-acetylesterase are a cause of autoimmune disease type 6 (AIS6). Individuals manifesting susceptibility to autoimmune disease type 6 can suffer from juvenile idiopathic arthritis, rheumatoid arthritis, multiple sclerosis, Sjogren syndrome, systemic lupus erythematosus, type 1 diabetes, ulcerative colitis, and Crohn disease.
References
  • Mandal C, et al. (2012) Regulation of O-acetylation of sialic acids by sialate-O-acetyltransferase and sialate-O-acetylesterase activities in childhood acute lymphoblastic leukemia. Glycobiology. 22(1): 70-83.
  • Tsai S, et al. (2011) Transcriptional profiling of human placentas from pregnancies complicated by preeclampsia reveals disregulation of sialic acid acetylesterase and immune signalling pathways. Placenta. 32 (2): 175-82.
  • Surolia I, et al. (2010) Functionally defective germline variants of sialic acid acetylesterase in autoimmunity. Nature. 466 (7303): 243-7.
  • TOP