Human SDPR Gene ORF cDNA clone expression plasmid,without any tag

Catalog Number:HGG884-UT

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1278bp
Gene Synonym
CAVIN2, PS-p68, SDR, cavin-2, SDPR
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human serum deprivation response Gene ORF cDNA clone expression plasmid,without any tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-untagged
Restriction Site
Protein Tag
Tag Sequence
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Serum deprivation-response protein, also known as Phosphatidylserine-binding protein, Cavin-2 and SDPR, is a member of the PTRF / SDPR family. SDPR is highly expressed in heart and lung, and expressed at lower levels in brain, kidney, liver, pancreas, placenta, and skeletal muscle. SDPR is a new regulator of caveolae biogenesis. SDPR is up-regulated in asyncronously growing fibroblasts following serum deprivation but not following contact inhibition and Down-regulated during synchronous cell cycle re-entry. Caveolae are plasma membrane invaginations with a characteristic flask-shaped morphology. They function in diverse cellular processes, including endocytosis. Loss of SDPR causes loss of caveolae. SDPR binds directly to PTRF and recruits PTRF to caveolar membranes. Overexpression of SDPR, unlike PTRF, induces deformation of caveolae and extensive tubulation of the plasma membrane. SDPR overexpression results in increased caveolae size and leads to the formation of caveolae-derived tubules containing Shiga toxin. SDPR is a membrane curvature inducing component of caveolae, and that STB-induced membrane tubulation is facilitated by caveolae. Pleckstrin and SDPR are phosphorylated by protein kinase C (PKC), the interaction between pleckstrin and SDPR was shown to be independent of PKC inhibition or activation. SDPR may facilitate the translocation of nonphosphorylated pleckstrin to the plasma membrane in conjunction with phosphoinositides that bind to the C-terminal PH domain.
References
  • Li,X. et al., 2008, Cancer Sci. 99 (7):1326-33.
  • Hansen,C.G. et al., 2009, Nat Cell Biol. 11 (7):807-14.
  • Baig,A. et al., 2009, Platelets. 20 (7):446-57.
  • Nabi,IR. et al., 2009, Nat Cell Biol.11 (7):789-91.
  • TOP