Human SDPR Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Human

NCBI Ref Seq

BC016475

RefSeq ORF Size

1278bp

Gene Synonym

CAVIN2, PS-p68, SDR, cavin-2, SDPR

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human serum deprivation response Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Serum deprivation-response protein, also known as Phosphatidylserine-binding protein, Cavin-2 and SDPR, is a member of the PTRF / SDPR family. SDPR is highly expressed in heart and lung, and expressed at lower levels in brain, kidney, liver, pancreas, placenta, and skeletal muscle. SDPR is a new regulator of caveolae biogenesis. SDPR is up-regulated in asyncronously growing fibroblasts following serum deprivation but not following contact inhibition and Down-regulated during synchronous cell cycle re-entry. Caveolae are plasma membrane invaginations with a characteristic flask-shaped morphology. They function in diverse cellular processes, including endocytosis. Loss of SDPR causes loss of caveolae. SDPR binds directly to PTRF and recruits PTRF to caveolar membranes. Overexpression of SDPR, unlike PTRF, induces deformation of caveolae and extensive tubulation of the plasma membrane. SDPR overexpression results in increased caveolae size and leads to the formation of caveolae-derived tubules containing Shiga toxin. SDPR is a membrane curvature inducing component of caveolae, and that STB-induced membrane tubulation is facilitated by caveolae. Pleckstrin and SDPR are phosphorylated by protein kinase C (PKC), the interaction between pleckstrin and SDPR was shown to be independent of PKC inhibition or activation. SDPR may facilitate the translocation of nonphosphorylated pleckstrin to the plasma membrane in conjunction with phosphoinositides that bind to the C-terminal PH domain.

References

Li,X. et al., 2008, Cancer Sci. 99 (7):1326-33.

Hansen,C.G. et al., 2009, Nat Cell Biol. 11 (7):807-14.

Baig,A. et al., 2009, Platelets. 20 (7):446-57.

Nabi,IR. et al., 2009, Nat Cell Biol.11 (7):789-91.

Catalog Number:HGG884-NM