Cynomolgus SCN2B Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:HGG861-NY

Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
648bp
Gene Synonym
SCN2B
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Cynomolgus sodium channel, voltage-gated, type II, beta subunit Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
SCN2B plays a key role in the assembly, expression, and functional modulation of the heterotrimeric complex of the sodium channel. Voltage-gated sodium channels (NaV) are composed of one pore-forming alpha-subunit, which may be associated with either one or more beta-subunits. Alpha-subunits are composed for four homologous domains, each of which contains six transmembrane segments.They are responsible for action potential initiation and propagation in excitable cells, including nerve, muscle, and neuroendocrine cell types. SCN2B causes an increase in the plasma membrane surface area and in its folding into microvilli. SCN2B also interacts with TNR and may play a crucial role in clustering and regulation of activity of sodium channels at nodes of ranvier.
References
  • Kimura K, et al. (2006) Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes. Genome Res. 16(1):55-65.
  • Tan BH, et al. (2010) Sudden infant death syndrome-associated mutations in the sodium channel beta subunits. Heart Rhythm. 7(6):771-8.
  • Watanabe H, et al. (2009) Mutations in sodium channel beta1- and beta2-subunits associated with atrial fibrillation. Circ Arrhythm Electrophysiol. 2(3):268-75. Kimura K et al., 2006, Genome Res. 16(1):55-65.
  • TOP