Cynomolgus SCN2B Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Cynomolgus

NCBI Ref Seq

XM_005579786.1

RefSeq ORF Size

648bp

Gene Synonym

SCN2B

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Cynomolgus sodium channel, voltage-gated, type II, beta subunit Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

SCN2B plays a key role in the assembly, expression, and functional modulation of the heterotrimeric complex of the sodium channel. Voltage-gated sodium channels (NaV) are composed of one pore-forming alpha-subunit, which may be associated with either one or more beta-subunits. Alpha-subunits are composed for four homologous domains, each of which contains six transmembrane segments.They are responsible for action potential initiation and propagation in excitable cells, including nerve, muscle, and neuroendocrine cell types. SCN2B causes an increase in the plasma membrane surface area and in its folding into microvilli. SCN2B also interacts with TNR and may play a crucial role in clustering and regulation of activity of sodium channels at nodes of ranvier.

References

Kimura K, et al. (2006) Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes. Genome Res. 16(1):55-65.

Tan BH, et al. (2010) Sudden infant death syndrome-associated mutations in the sodium channel beta subunits. Heart Rhythm. 7(6):771-8.

Watanabe H, et al. (2009) Mutations in sodium channel beta1- and beta2-subunits associated with atrial fibrillation. Circ Arrhythm Electrophysiol. 2(3):268-75. Kimura K et al., 2006, Genome Res. 16(1):55-65.

Catalog Number:HGG861-CM