Human S100A7 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Gene

Species

Human

NCBI Ref Seq

NM_002963.3

RefSeq ORF Size

351 bp

Gene Synonym

PSOR1, S100A7c, S100A7

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human S100 calcium binding protein A7 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-OFPSpark

Restriction Site

KpnI + XbaI(6kb+0.35kb)

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Protein S100-A7, also known as S100 calcium-binding protein A7, Psoriasin, S100A7, and PSOR1, is a secreted protein which belongs to the S-100 family. S100A7 was first isolated from skin involved by psoriasis, which can be induced in cultured squamous epithelial cells. S100A7 is expressed by both normal cultured and malignant keratinocytes and malignant breast epithelial cells within ductal carcinoma in situ, suggesting an association with abnormal pathways of differentiation. S100A7 plays a role in the pathogenesis of inflammatory skin disease, as a chemotactic factor for hematopoietic cells. It also plays a role in early stages of breast tumor progression in association with the development of the invasive phenotype.

References

Miyasaki, KT. et al., 1993, J. Dent. Res. 72: 517-23.

Watson, PH. et al., 1998, Int J Biochem Cell Biol 30 (5):567-71.

Emberley, ED. et al., 2004, Breast Cancer Res 6 (4): 153-9.

Ohuchida, K. et al., 2006, Clin Cancer Res 12 (18):5417-22.

Kouno, T. et al., 2008, J Pept Sci. 14 (10):1129-38.

León, R. et al., 2009, Biochemistry. 48 (44): 10591-600.

Catalog Number:HGG801-NO