Human S100A7 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:HGG801-CY

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
351 bp
Gene Synonym
PSOR1, S100A7c, S100A7
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human S100 calcium binding protein A7 Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
KpnI + XbaI(6kb+0.35kb)
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Protein S100-A7, also known as S100 calcium-binding protein A7, Psoriasin, S100A7, and PSOR1, is a secreted protein which belongs to the S-100 family. S100A7 was first isolated from skin involved by psoriasis, which can be induced in cultured squamous epithelial cells. S100A7 is expressed by both normal cultured and malignant keratinocytes and malignant breast epithelial cells within ductal carcinoma in situ, suggesting an association with abnormal pathways of differentiation. S100A7 plays a role in the pathogenesis of inflammatory skin disease, as a chemotactic factor for hematopoietic cells. It also plays a role in early stages of breast tumor progression in association with the development of the invasive phenotype.
References
  • Miyasaki, KT. et al., 1993, J. Dent. Res. 72: 517-23.
  • Watson, PH. et al., 1998, Int J Biochem Cell Biol  30 (5):567-71.
  • Emberley, ED. et al., 2004, Breast Cancer Res  6 (4): 153-9.
  • Ohuchida, K. et al., 2006, Clin Cancer Res  12 (18):5417-22.
  • Kouno, T. et al., 2008, J Pept Sci. 14 (10):1129-38.
  • León, R. et al., 2009, Biochemistry. 48 (44): 10591-600.
  • TOP