Human S100A4 transcript variant 1 Gene ORF cDNA clone expression plasmid,C terminal GFP tag

Catalog Number:HGG798-CG

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
306bp
Gene Synonym
S100A4, 42A, 18A2, CAPL, FSP1, MTS1, P9KA, PEL98
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human S100 calcium binding protein A4, transcript variant 1 Gene ORF cDNA clone expression plasmid,C terminal GFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-GFPSpark
Restriction Site
Protein Tag
GFPSpark
Tag Sequence
GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
GFPSpark Tag Information
GFPSpark is an improved variant of the green fluorescent protein GFP. It possesses bright green fluorescence (excitation/ emission max = 487 / 508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. GFPSpark is mainly intended for applications where fast appearance of bright fluorescence is crucial. It is specially recommended for cell and organelle labeling and tracking the promoter activity.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
S100A4, also known as metastasis-associated protein Mtsl, belongs to the family of small calcium-binding S100 proteins containing two EF-hand calcium-binding motifs. In humans at least 20 S100 family members that are distributed tissue specifically have been identified, and are involved in a number of cellular processes as transducers of calcium signal. S100A4 is a symmetric homodimer, and undergoes a relatively large conformational change upon the typical EF-hand binding calcium, which is necessary for S100A4 to interact with its protein targets and generate biological effects. It can bind the already known targets p53, F-actin, liprin β, myosin heavy chain II, and prevent their phosphorylation and multimerization. It has been demonstrated that S100A4 is directly involved in tumor metastasis including cell motility, invasion, apoptosis, angiogenesis and differentiation, and appears to be a metastasis factor and a molecular marker for clinical prognosis. Multiple alternatively spliced variants encoding the same protein have been identified.
References
  • Ambartsumian N. et al., 1995, Gene. 159: 125-30.
  • Marenholz I. et al., 2004, Biochem Biophys Res Commun. 322: 1111-22.
  • Helfman DM. et al., 2005, Br J Cancer. 92: 1955-8.
  • Saleem M. et al., 2006, Proc Natl Acad Sci. 103: 14825-30.
  • Boye K. et al., 2008, Int J Cancer. 123: 1301-10.
  • Garrett SC. et al., 2006, J Biol Chem. 281: 677-80.
  • Kriajevska M. et al., 2002, J Biol Chem. 277: 5299-335.
  • TOP