Human S100A4 transcript variant 1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:HGG798-CF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
306bp
Gene Synonym
S100A4, 42A, 18A2, CAPL, FSP1, MTS1, P9KA, PEL98
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human S100 calcium binding protein A4, transcript variant 1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
S100A4, also known as metastasis-associated protein Mtsl, belongs to the family of small calcium-binding S100 proteins containing two EF-hand calcium-binding motifs. In humans at least 20 S100 family members that are distributed tissue specifically have been identified, and are involved in a number of cellular processes as transducers of calcium signal. S100A4 is a symmetric homodimer, and undergoes a relatively large conformational change upon the typical EF-hand binding calcium, which is necessary for S100A4 to interact with its protein targets and generate biological effects. It can bind the already known targets p53, F-actin, liprin β, myosin heavy chain II, and prevent their phosphorylation and multimerization. It has been demonstrated that S100A4 is directly involved in tumor metastasis including cell motility, invasion, apoptosis, angiogenesis and differentiation, and appears to be a metastasis factor and a molecular marker for clinical prognosis. Multiple alternatively spliced variants encoding the same protein have been identified.
References
  • Ambartsumian N. et al., 1995, Gene. 159: 125-30.
  • Marenholz I. et al., 2004, Biochem Biophys Res Commun. 322: 1111-22.
  • Helfman DM. et al., 2005, Br J Cancer. 92: 1955-8.
  • Saleem M. et al., 2006, Proc Natl Acad Sci. 103: 14825-30.
  • Boye K. et al., 2008, Int J Cancer. 123: 1301-10.
  • Garrett SC. et al., 2006, J Biol Chem. 281: 677-80.
  • Kriajevska M. et al., 2002, J Biol Chem. 277: 5299-335.
  • TOP