Human S100A2 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Human

NCBI Ref Seq

NM_005978.3

RefSeq ORF Size

294bp

Gene Synonym

S100A2, CAN19, S100L, MGC111539

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human S100 calcium binding protein A2 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

The calcium-binding Protein S100A2 is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 family genes are located as a cluster on chromosome 1q21, and S100 proteins consisting of at least 20 members are involved in the regulation of a number of cellular processes such as cell-cycle progression and cell differentiation. S100A2 was first detected in lung and kidney, and is mainly expressed in a subset of tissues and cells such as breast epithelia and liver. The S100A2 protein is a homodimer that undergoes a conformational change upon binding of calcium, and the active form functions in regulating cell proliferation and differentiation, gene transcription, and p53-dependent growth arrest and apoptosis. Accordingly, this protein is regarded as a putative tumor suppressor, and thus chromosomal rearrangements and reduced expression of S100A2 gene have been implicated in certain carcinomas.

References

Gimona, M. et al., 1997, J. Cell. Sci. 110: 611-621.

Mueller, A. et al., 2005, J. Biol. Chem. 280: 29186-29193.

Lapi, E. et al., 2006, Oncogene. 25: 3628-3637.

Feng, G. et al., 2001, Cancer. Res. 61: 7999-8004.

Gupta, S. et al., 2003, J. Clin. Oncol. 21: 106-112.

Catalog Number:HGG795-NM