Human S100A2 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:HGG795-CM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
294bp
Gene Synonym
S100A2, CAN19, S100L, MGC111539
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human S100 calcium binding protein A2 Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
The calcium-binding Protein S100A2 is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 family genes are located as a cluster on chromosome 1q21, and S100 proteins consisting of at least 20 members are involved in the regulation of a number of cellular processes such as cell-cycle progression and cell differentiation. S100A2 was first detected in lung and kidney, and is mainly expressed in a subset of tissues and cells such as breast epithelia and liver. The S100A2 protein is a homodimer that undergoes a conformational change upon binding of calcium, and the active form functions in regulating cell proliferation and differentiation, gene transcription, and p53-dependent growth arrest and apoptosis. Accordingly, this protein is regarded as a putative tumor suppressor, and thus chromosomal rearrangements and reduced expression of S100A2 gene have been implicated in certain carcinomas.
References
  • Gimona, M. et al., 1997, J. Cell. Sci. 110: 611-621.
  • Mueller, A. et al., 2005, J. Biol. Chem. 280: 29186-29193.
  • Lapi, E. et al., 2006, Oncogene. 25: 3628-3637.
  • Feng, G. et al., 2001, Cancer. Res. 61: 7999-8004.
  • Gupta, S. et al., 2003, J. Clin. Oncol. 21: 106-112.
  • TOP