Human RUVBL1 / RVB1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:HGG780-NM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1371bp
Gene Synonym
RVB1, TIH1, ECP54, TIP49, INO80H, NMP238, PONTIN, TIP49A, Pontin52
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human RuvB-like 1 (E. coli) Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
RUVBL1, also known as RVB1, is a component of the NuA4 histone acetyltransferase complex and belongs to the RuvB family. RUVBL1 is ubiquitously expressed with high expression in heart, skeletal muscle and testis. It possesses single-stranded DNA-stimulated ATPase and ATP-dependent DNA helicase (3' to 5') activity. RUVBL1 is involved in transcriptional activation of select genes principally by acetylation of nucleosomal histones H4 and H2A. RUVBL1 plays an essential role in oncogenic transformation by MYC and also modulates transcriptional activation by the LEF1/TCF1-CTNNB1 complex. It also is essential for cell proliferation. RUVBL1 may be able to bind plasminogen at cell surface and enhance plasminogen activation.
References
  • Bauer A, et al. (1998) Pontin52, an interaction partner of beta-catenin, binds to the TATA box binding protein. Proc Natl Acad Sci. 95(25):14787-92.
  • Ewing, et al. (2007) Large-scale mapping of human protein-protein interactions by mass spectrometry. Mol Syst Biol. 3(1):89.
  • Puri T, et al. (2007) Dodecameric structure and ATPase activity of the human TIP48/TIP49 complex. J Mol Biol. 366(1):179-92.
  • TOP