Human RUVBL1 / RVB1 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Human

NCBI Ref Seq

BC004531

RefSeq ORF Size

1371bp

Gene Synonym

RVB1, TIH1, ECP54, TIP49, INO80H, NMP238, PONTIN, TIP49A, Pontin52

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human RuvB-like 1 (E. coli) Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

RUVBL1, also known as RVB1, is a component of the NuA4 histone acetyltransferase complex and belongs to the RuvB family. RUVBL1 is ubiquitously expressed with high expression in heart, skeletal muscle and testis. It possesses single-stranded DNA-stimulated ATPase and ATP-dependent DNA helicase (3' to 5') activity. RUVBL1 is involved in transcriptional activation of select genes principally by acetylation of nucleosomal histones H4 and H2A. RUVBL1 plays an essential role in oncogenic transformation by MYC and also modulates transcriptional activation by the LEF1/TCF1-CTNNB1 complex. It also is essential for cell proliferation. RUVBL1 may be able to bind plasminogen at cell surface and enhance plasminogen activation.

References

Bauer A, et al. (1998) Pontin52, an interaction partner of beta-catenin, binds to the TATA box binding protein. Proc Natl Acad Sci. 95(25):14787-92.

Ewing, et al. (2007) Large-scale mapping of human protein-protein interactions by mass spectrometry. Mol Syst Biol. 3(1):89.

Puri T, et al. (2007) Dodecameric structure and ATPase activity of the human TIP48/TIP49 complex. J Mol Biol. 366(1):179-92.

Catalog Number:HGG780-CY