Mouse RTN4/NOGO-A Gene ORF cDNA clone expression plasmid,N terminal His tag

Gene

Species

Mouse

NCBI Ref Seq

RefSeq ORF Size

600bp

Gene Synonym

ASY; NgA; NOGO; NSP-CL; Nogo-A; Nogo-B; Nogo-C; AA407876; AA409940; AA960376; mKIAA0886; mKIAA4153; 1110020G17Rik; C130026I10Rik

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse reticulon 4 Gene ORF cDNA clone expression plasmid,N terminal His tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-His

Restriction Site

Protein Tag

His

Tag Sequence

CACCATCACCACCATCATCACCACCATCAC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

His Tag Information

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Reticulon-4, also known as Foocen, Neurite outgrowth inhibitor, Nogo protein, Neuroendocrine-specific protein, Neuroendocrine-specific protein C homolog, RTN-x, Reticulon-5 and RTN4, is a multi-pass membrane protein which contains one reticulon domain. Isoform 1 of RTN4 is specifically expressed in brain and testis and weakly in heart and skeletal muscle. Isoform 2 of RTN4 is widely expressed except for the liver. Isoform 3 of RTN4 is expressed in brain, skeletal muscle and adipocytes. Isoform 4 of RTN4 is testis-specific. Reticulon-4 / RTN4 is a developmental neurite growth regulatory factor with a role as a negative regulator of axon-axon adhesion and growth, and as a facilitator of neurite branching. Reticulon-4 / RTN4 regulates neurite fasciculation, branching and extension in the developing nervous system. Reticulon-4 / RTN4 is involved in down-regulation of growth, stabilization of wiring and restriction of plasticity in the adult CNS. It regulates the radial migration of cortical neurons via an RTN4R-LINGO1 containing receptor complex. Isoform 2 of RTN4 reduces the anti-apoptotic activity of Bcl-xl and Bcl-2. This is likely consecutive to their change in subcellular location, from the mitochondria to the endoplasmic reticulum, after binding and sequestration. Isoform 2 and isoform 3 of RTN4 inhibit BACE1 activity and amyloid precursor protein processing.

References

Yang J., et al., 2000, Cytogenet. Cell Genet. 88:101-102.

Prinjha R., et al., 2000, Nature 403: 383-384.

Tagami S., et al., 2000, Oncogene 19: 5736-5746.

Murayama K.S., et al., 2006, Eur. J. Neurosci. 24: 1237-1244.

Daub H., et al., 2008, Mol. Cell 31:438-448.

Choudhary C., et al., 2009, Science 325: 834-840.

Catalog Number:HGG771-NH