Mouse RTN4/NOGO-A Gene ORF cDNA clone expression plasmid,C terminal GFP tag

Gene

Species

Mouse

NCBI Ref Seq

RefSeq ORF Size

600bp

Gene Synonym

ASY; NgA; NOGO; NSP-CL; Nogo-A; Nogo-B; Nogo-C; AA407876; AA409940; AA960376; mKIAA0886; mKIAA4153; 1110020G17Rik; C130026I10Rik

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse reticulon 4 Gene ORF cDNA clone expression plasmid,C terminal GFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-GFPSpark

Restriction Site

Protein Tag

GFPSpark

Tag Sequence

GTGAGCAAGGGC……GAGCTGTACAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

GFPSpark Tag Information

GFPSpark is an improved variant of the green fluorescent protein GFP. It possesses bright green fluorescence (excitation/ emission max = 487 / 508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. GFPSpark is mainly intended for applications where fast appearance of bright fluorescence is crucial. It is specially recommended for cell and organelle labeling and tracking the promoter activity.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Reticulon-4, also known as Foocen, Neurite outgrowth inhibitor, Nogo protein, Neuroendocrine-specific protein, Neuroendocrine-specific protein C homolog, RTN-x, Reticulon-5 and RTN4, is a multi-pass membrane protein which contains one reticulon domain. Isoform 1 of RTN4 is specifically expressed in brain and testis and weakly in heart and skeletal muscle. Isoform 2 of RTN4 is widely expressed except for the liver. Isoform 3 of RTN4 is expressed in brain, skeletal muscle and adipocytes. Isoform 4 of RTN4 is testis-specific. Reticulon-4 / RTN4 is a developmental neurite growth regulatory factor with a role as a negative regulator of axon-axon adhesion and growth, and as a facilitator of neurite branching. Reticulon-4 / RTN4 regulates neurite fasciculation, branching and extension in the developing nervous system. Reticulon-4 / RTN4 is involved in down-regulation of growth, stabilization of wiring and restriction of plasticity in the adult CNS. It regulates the radial migration of cortical neurons via an RTN4R-LINGO1 containing receptor complex. Isoform 2 of RTN4 reduces the anti-apoptotic activity of Bcl-xl and Bcl-2. This is likely consecutive to their change in subcellular location, from the mitochondria to the endoplasmic reticulum, after binding and sequestration. Isoform 2 and isoform 3 of RTN4 inhibit BACE1 activity and amyloid precursor protein processing.

References

Yang J., et al., 2000, Cytogenet. Cell Genet. 88:101-102.

Prinjha R., et al., 2000, Nature 403: 383-384.

Tagami S., et al., 2000, Oncogene 19: 5736-5746.

Murayama K.S., et al., 2006, Eur. J. Neurosci. 24: 1237-1244.

Daub H., et al., 2008, Mol. Cell 31:438-448.

Choudhary C., et al., 2009, Science 325: 834-840.

Catalog Number:HGG771-CG