Human RNASET2 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:HGG612-NO

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
771bp
Gene Synonym
RNASE6PL, bA514O12.3, RP11-514O12.3, RNASET2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human ribonuclease T2 Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
RNASET2 (ribonuclease T2) is an enzyme which belongs to the RNase T2 family. It is highly expressed in the temporal lobe and fetal brain. RNASET2 gene is a novel member of the Rh/T2/S-glycoprotein class of extracellular ribonucleases. It is a single copy gene that maps to 6q27, a region associated with human malignancies and chromosomal rearrangement. Defects in RNASET2 are the cause of leukoencephalopathy cystic without megalencephaly. An infantile-onset syndrome of cerebral leukoencephalopathy. Affected newborns develop microcephaly and neurologic abnormalities including psychomotor impairment, seizures and sensorineural hearing impairment. The brain shows multifocal white matter lesions, anterior temporal lobe subcortical cysts, pericystic abnormal myelination, ventriculomegaly and intracranial calcifications.
References
  • Acquati F, et al. (2011) A Molecular signature induced by RNASET2, a tumor antagonizing gene, in ovarian cancer cells. Oncotarget. 2(6):477-84.
  • Campomenosi P, et al. (2011) Comparison of the baculovirus-insect cell and Pichia pastoris heterologous systems for the expression of the human tumor suppressor protein RNASET2. Biotechnol Appl Biochem. 58(1):39-49.
  • Monti L, et al. (2008) RNASET2 as a tumor antagonizing gene in a melanoma cancer model. Oncol Res. 17(2):69-74.
  • TOP