Human RNASET2 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:HGG612-CF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
771bp
Gene Synonym
RNASE6PL, bA514O12.3, RP11-514O12.3, RNASET2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human ribonuclease T2 Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
RNASET2 (ribonuclease T2) is an enzyme which belongs to the RNase T2 family. It is highly expressed in the temporal lobe and fetal brain. RNASET2 gene is a novel member of the Rh/T2/S-glycoprotein class of extracellular ribonucleases. It is a single copy gene that maps to 6q27, a region associated with human malignancies and chromosomal rearrangement. Defects in RNASET2 are the cause of leukoencephalopathy cystic without megalencephaly. An infantile-onset syndrome of cerebral leukoencephalopathy. Affected newborns develop microcephaly and neurologic abnormalities including psychomotor impairment, seizures and sensorineural hearing impairment. The brain shows multifocal white matter lesions, anterior temporal lobe subcortical cysts, pericystic abnormal myelination, ventriculomegaly and intracranial calcifications.
References
  • Acquati F, et al. (2011) A Molecular signature induced by RNASET2, a tumor antagonizing gene, in ovarian cancer cells. Oncotarget. 2(6):477-84.
  • Campomenosi P, et al. (2011) Comparison of the baculovirus-insect cell and Pichia pastoris heterologous systems for the expression of the human tumor suppressor protein RNASET2. Biotechnol Appl Biochem. 58(1):39-49.
  • Monti L, et al. (2008) RNASET2 as a tumor antagonizing gene in a melanoma cancer model. Oncol Res. 17(2):69-74.
  • TOP