Human Relaxin-1 / RLN1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Gene

Species

Human

NCBI Ref Seq

NM_006911.2

RefSeq ORF Size

558bp

Gene Synonym

H1, RLXH1, bA12D24.3.1, bA12D24.3.2, RLN1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human relaxin 1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Relaxin-1, also known as Prorelaxin H1 and RLN1, is a secreted protein which belongs to the insulin family. It is a peptide hormone that was first described in 1926 by Frederick Hisaw. Since its discovery as a reproductive hormone 80 years ago, relaxin has been implicated in a number of pregnancy-related functions involving extracellular matrix (ECM) turnover and collagen degradation. It is now becoming evident that relaxin's ability to reduce matrix synthesis and increase ECM degradation has important implications in several nonreproductive organs, including the heart, lung, kidney, liver and skin. The relaxin-like peptide family belongs in the insulin superfamily and consists of 7 peptides of high structural but low sequence similarity; relaxin-1 (RNL1), relaxin-2 (RNL2) and relaxin-3 ( RNL3), and the insulin-like (INSL) peptides, INSL3, INSL4, INSL5 and INSL6. The functions of relaxin-3, INSL4, INSL5, INSL6 remain uncharacterised. Relaxin-1 / RLN1 is an ovarian hormone that acts with estrogen to produce dilatation of the birth canal in many mammals. Relaxin-1 / RLN1 may be involved in remodeling of connective tissues during pregnancy, promoting growth of pubic ligaments and ripening of the cervix. Relaxin and estrogen appear to play protective roles against airway fibrosis, airway SM thickening, and cardiac hypertrophy. Relaxin may also provide a means to regulate excessive collagen deposition during kidney development and in diseased states characterized by renal fibrosis.

References

Bathgate,R.A. et al., 2003, ends Endocrinol Metab 14 (5):207-13.

Samuel,C.S. et al., 2003, Curr Opin Pharmacol. 3 (2):152-8.

Samuel,C.S. et al., 2004,Kidney Int. 65 (6):2054-64.

Lekgabe,E.D. et al., 2006, Endocrinology. 147 (12):5575-83.

Samuel,C.S. et al., 2007, Adv Exp Med Biol 612: 88-103.

Catalog Number:HGG489-NF