Human Relaxin-1 / RLN1 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:HGG489-CM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
558bp
Gene Synonym
H1, RLXH1, bA12D24.3.1, bA12D24.3.2, RLN1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human relaxin 1 Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Relaxin-1, also known as Prorelaxin H1 and RLN1, is a secreted protein which belongs to the insulin family. It is a peptide hormone that was first described in 1926 by Frederick Hisaw. Since its discovery as a reproductive hormone 80 years ago, relaxin has been implicated in a number of pregnancy-related functions involving extracellular matrix (ECM) turnover and collagen degradation. It is now becoming evident that relaxin's ability to reduce matrix synthesis and increase ECM degradation has important implications in several nonreproductive organs, including the heart, lung, kidney, liver and skin. The relaxin-like peptide family belongs in the insulin superfamily and consists of 7 peptides of high structural but low sequence similarity; relaxin-1 (RNL1), relaxin-2 (RNL2) and relaxin-3 ( RNL3), and the insulin-like (INSL) peptides, INSL3, INSL4, INSL5 and INSL6. The functions of relaxin-3, INSL4, INSL5, INSL6 remain uncharacterised. Relaxin-1 / RLN1 is an ovarian hormone that acts with estrogen to produce dilatation of the birth canal in many mammals. Relaxin-1 / RLN1 may be involved in remodeling of connective tissues during pregnancy, promoting growth of pubic ligaments and ripening of the cervix. Relaxin and estrogen appear to play protective roles against airway fibrosis, airway SM thickening, and cardiac hypertrophy. Relaxin may also provide a means to regulate excessive collagen deposition during kidney development and in diseased states characterized by renal fibrosis.
References
  • Bathgate,R.A. et al., 2003, ends Endocrinol Metab  14 (5):207-13.
  • Samuel,C.S. et al., 2003, Curr Opin Pharmacol. 3 (2):152-8.
  • Samuel,C.S. et al., 2004,Kidney Int. 65 (6):2054-64.
  • Lekgabe,E.D. et al., 2006, Endocrinology. 147 (12):5575-83.
  • Samuel,C.S. et al., 2007, Adv Exp Med Biol  612: 88-103.
  • TOP