Rhesus REG1B Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Catalog Number:HGG482-CO

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
501bp
Gene Synonym
REG1B
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rhesus regenerating islet-derived 1 beta Gene ORF cDNA clone expression plasmid,C terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Regenerating gene (Reg), first isolated from a regenerating islet cDNA library, encodes a secretory protein with a growth stimulating effect on pancreatic beta cells, and could be associated with fibrocalculous pancreatopathy. Reg and Reg-related genes which were expressed in various organs have been revealed to constitute a multigene family, the Reg family consisting of four subtypes (types I, II, III, IV) and are involved in cancers and neurodegenerative diseases. Regenerating islet-derived 1 beta (REG1B), also known as Lithostathine-1-beta and Pancreatic stone protein 2 (PSPS2), is a types I Reg protein and contains one typical C-type lectin domain. REG1B is a 166-amino acid protein which has 22 amino acid substitutions in comparison with the previously isolated human REG1A, and it is was expressed only in pancreas. REG1B Is normally found in the exocrine pancreas, whereas in other tissues it appears either only under pathological conditions, such as Alzheimer's disease (brain), cancer (colon), or during regeneration such as neuronal sprouting in brain and pancreas regeneration. REG1B might act as an inhibitor of spontaneous calcium carbonate precipitation. The REG1A and REG1B gene and proteins could play different roles in the pancreas.
References
  • Moriizumi S, et al. (1994) Isolation, structural determination and expression of a novel reg gene, human regI beta. Biochim Biophys Acta. 1217(2): 199-202.
  • Sanchez D, et al. (2001) Preferential expression of reg I beta gene in human adult pancreas. Biochem Biophys Res Commun. 284(3): 729-37.
  • Boonyasrisawat W, et al. (2002) Analysis of the reg1alpha and reg1beta gene transcripts in patients with fibrocalculous pancreatopathy. Southeast Asian J Trop Med Public Health. 33(2): 365-72.
  • TOP