Rhesus REG1B Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Rhesus

NCBI Ref Seq

NM_001194568.1

RefSeq ORF Size

501bp

Gene Synonym

REG1B

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rhesus regenerating islet-derived 1 beta Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Regenerating gene (Reg), first isolated from a regenerating islet cDNA library, encodes a secretory protein with a growth stimulating effect on pancreatic beta cells, and could be associated with fibrocalculous pancreatopathy. Reg and Reg-related genes which were expressed in various organs have been revealed to constitute a multigene family, the Reg family consisting of four subtypes (types I, II, III, IV) and are involved in cancers and neurodegenerative diseases. Regenerating islet-derived 1 beta (REG1B), also known as Lithostathine-1-beta and Pancreatic stone protein 2 (PSPS2), is a types I Reg protein and contains one typical C-type lectin domain. REG1B is a 166-amino acid protein which has 22 amino acid substitutions in comparison with the previously isolated human REG1A, and it is was expressed only in pancreas. REG1B Is normally found in the exocrine pancreas, whereas in other tissues it appears either only under pathological conditions, such as Alzheimer's disease (brain), cancer (colon), or during regeneration such as neuronal sprouting in brain and pancreas regeneration. REG1B might act as an inhibitor of spontaneous calcium carbonate precipitation. The REG1A and REG1B gene and proteins could play different roles in the pancreas.

References

Moriizumi S, et al. (1994) Isolation, structural determination and expression of a novel reg gene, human regI beta. Biochim Biophys Acta. 1217(2): 199-202.

Sanchez D, et al. (2001) Preferential expression of reg I beta gene in human adult pancreas. Biochem Biophys Res Commun. 284(3): 729-37.

Boonyasrisawat W, et al. (2002) Analysis of the reg1alpha and reg1beta gene transcripts in patients with fibrocalculous pancreatopathy. Southeast Asian J Trop Med Public Health. 33(2): 365-72.

Catalog Number:HGG482-CF