Human PTP1B / PTPN1 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:HGG269-NO

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1308bp
Gene Synonym
PTP1B
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human protein tyrosine phosphatase, non-receptor type 1 Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
PTP1B, also known as PTPN1, belongs to the protein-tyrosine phosphatase (PTP) family. PTPs catalyze the hydrolysis of the phosphate monoesters specifically on tyrosine residues. Members of the PTP family share a highly conserved catalytic motif, which is essential for the catalytic activity. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. PTP1B contains 1 tyrosine-protein phosphatase domain and is expressed in many tissues. PTP1B is localized to the cytoplasmic face of the endoplasmic reticulum. PTP1B was also reported to dephosphorylate epidermal growth factor receptor kinase, as well as JAK2 and TYK2 kinases, which implicated the role of PTP1B in cell growth control, and cell response to IFN stimulation.
References
  • Frangioni JV, et al. (1992) The nontransmembrane tyrosine phosphatase PTP-1B localizes to the endoplasmic reticulum via its 35 amino acid C-terminal sequence. Cell. 68(3):545-60.
  • Zhu S, et al. (2007) PTP1B contributes to the oncogenic properties of colon cancer cells through Src activation. Cancer Res. 67(21):10129-37.
  • Aoki N, et al. (2000) A cytosolic protein-tyrosine phosphatase PTP1B specifically dephosphorylates and deactivates prolactin-activated STAT5a and STAT5b. J Biol Chem. 275(50):39718-26.
  • Stuible M, et al. (2008) PTP1B regulates cortactin tyrosine phosphorylation by targeting Tyr446. J Biol Chem. 283(23):15740-6.
  • TOP