Human PTP1B / PTPN1 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Gene

Species

Human

NCBI Ref Seq

NM_002827.2

RefSeq ORF Size

1308bp

Gene Synonym

PTP1B

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human protein tyrosine phosphatase, non-receptor type 1 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

PTP1B, also known as PTPN1, belongs to the protein-tyrosine phosphatase (PTP) family. PTPs catalyze the hydrolysis of the phosphate monoesters specifically on tyrosine residues. Members of the PTP family share a highly conserved catalytic motif, which is essential for the catalytic activity. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. PTP1B contains 1 tyrosine-protein phosphatase domain and is expressed in many tissues. PTP1B is localized to the cytoplasmic face of the endoplasmic reticulum. PTP1B was also reported to dephosphorylate epidermal growth factor receptor kinase, as well as JAK2 and TYK2 kinases, which implicated the role of PTP1B in cell growth control, and cell response to IFN stimulation.

References

Frangioni JV, et al. (1992) The nontransmembrane tyrosine phosphatase PTP-1B localizes to the endoplasmic reticulum via its 35 amino acid C-terminal sequence. Cell. 68(3):545-60.

Zhu S, et al. (2007) PTP1B contributes to the oncogenic properties of colon cancer cells through Src activation. Cancer Res. 67(21):10129-37.

Aoki N, et al. (2000) A cytosolic protein-tyrosine phosphatase PTP1B specifically dephosphorylates and deactivates prolactin-activated STAT5a and STAT5b. J Biol Chem. 275(50):39718-26.

Stuible M, et al. (2008) PTP1B regulates cortactin tyrosine phosphorylation by targeting Tyr446. J Biol Chem. 283(23):15740-6.

Catalog Number:HGG269-CO