Human PTH / PTH1 / Parathyroid Hormone Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Gene

Species

Human

NCBI Ref Seq

NM_000315.2

RefSeq ORF Size

348bp

Gene Synonym

PTH1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human parathyroid hormone Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Parathyroid hormone (PTH), parathormone or parathyrin, is secreted by the chief cells of the parathyroid glands as a polypeptide. PTH elevates calcium level by dissolving the salts in bone and preventing their renal excretion. Parathyroid hormone (PTH) has been proved to play a pivotal role in maintaining myocardial contractility as well as effective natriuresis, and possible pathogenic mechanisms contributing to heart failure secondary to hypocalcemia and hypoparathyroidism. With the increased population of preosteoblastic lineages and the osteoblastic activation, Parathyroid hormone (PTH) drives anabolism in bone. Experiments have recently reported that PTH affects bone cells in a dual pathway - mediating osteoblastic (preosteoblastic) activities or osteocytic synthesis of sclerostin. Defects in PTH are a cause of familial isolated hypoparathyroidism (FIH), also called autosomal dominant hypoparathyroidism or autosomal dominant hypocalcemia. FIH is characterized by hypocalcemia and hyperphosphatemia due to inadequate secretion of parathyroid hormone. Symptoms are seizures, tetany and cramps.

References

Bedi B, et al. (2012) Silencing of parathyroid hormone (PTH) receptor 1 in T cells blunts the bone anabolic activity of PTH. Proc Natl Acad Sci U S A. 109(12): 725-33.

Hasegawa T, et al. (2012) Parathyroid hormone as a Bone anabolic agent. Biological function of bone cells on the PTH-driven anabolic effect. Clin Calcium. 22(3): 373-9.

Ito M. Parathyroid hormone as a Bone anabolic agent. Effect of PTH on bone structural properties. Clin Calcium. 22(3): 335-41.

Catalog Number:HGG260-NO