Human PTH / PTH1 / Parathyroid Hormone Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Human

NCBI Ref Seq

NM_000315.2

RefSeq ORF Size

348bp

Gene Synonym

PTH1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human parathyroid hormone Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Parathyroid hormone (PTH), parathormone or parathyrin, is secreted by the chief cells of the parathyroid glands as a polypeptide. PTH elevates calcium level by dissolving the salts in bone and preventing their renal excretion. Parathyroid hormone (PTH) has been proved to play a pivotal role in maintaining myocardial contractility as well as effective natriuresis, and possible pathogenic mechanisms contributing to heart failure secondary to hypocalcemia and hypoparathyroidism. With the increased population of preosteoblastic lineages and the osteoblastic activation, Parathyroid hormone (PTH) drives anabolism in bone. Experiments have recently reported that PTH affects bone cells in a dual pathway - mediating osteoblastic (preosteoblastic) activities or osteocytic synthesis of sclerostin. Defects in PTH are a cause of familial isolated hypoparathyroidism (FIH), also called autosomal dominant hypoparathyroidism or autosomal dominant hypocalcemia. FIH is characterized by hypocalcemia and hyperphosphatemia due to inadequate secretion of parathyroid hormone. Symptoms are seizures, tetany and cramps.

References

Bedi B, et al. (2012) Silencing of parathyroid hormone (PTH) receptor 1 in T cells blunts the bone anabolic activity of PTH. Proc Natl Acad Sci U S A. 109(12): 725-33.

Hasegawa T, et al. (2012) Parathyroid hormone as a Bone anabolic agent. Biological function of bone cells on the PTH-driven anabolic effect. Clin Calcium. 22(3): 373-9.

Ito M. Parathyroid hormone as a Bone anabolic agent. Effect of PTH on bone structural properties. Clin Calcium. 22(3): 335-41.

Catalog Number:HGG260-CM