Human PSG6 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:HGG200-CY

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1275bp
Gene Synonym
PSBG-10, PSBG-12, PSBG-6, PSG10, PSG6
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human pregnancy specific beta-1-glycoprotein 6 Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
PSG6 is a pregnancy-specific glycoprotein(PSG). PSGs are secreted proteins which are produced by the rodent and primate placenta and play a critical role in pregnancy success. The levels of PSGs are highest during the third trimester of pregnancy, a time marked by the most profound suppression of MS disease attacks. PSGs regulate T-cell function. The regulation of T-cell function during pregnancy is likely the result of significant hormonal changes and may well involve immunoregulatory proteins derived from the placenta. Pregnancy specific glycoproteins (PSGs) are the most abundant placentally derived glycoproteins in the maternal serum. PSG1, PSG6, PSG6N, and PSG11 induce dose-dependent secretion of anti-inflammatory cytokines by human monocytes. Human and murine PSGs exhibit cross-species activity.
References
  • Teglund S, et al. (1995) Characterization of cDNA encoding novel pregnancy-specific glycoprotein variants. Biochem Biophys Res Commun. 211(2):656-64.
  • Grimwood J, et al.. (2004) The DNA sequence and biology of human chromosome 19. Nature. 428(6982):529-35.
  • Gerhard DS, et al. (2004) The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). Genome Res. 14(10B):2121-7.
  • TOP