Human PSG6 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Catalog Number:HGG200-CO

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1275bp
Gene Synonym
PSBG-10, PSBG-12, PSBG-6, PSG10, PSG6
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human pregnancy specific beta-1-glycoprotein 6 Gene ORF cDNA clone expression plasmid,C terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
PSG6 is a pregnancy-specific glycoprotein(PSG). PSGs are secreted proteins which are produced by the rodent and primate placenta and play a critical role in pregnancy success. The levels of PSGs are highest during the third trimester of pregnancy, a time marked by the most profound suppression of MS disease attacks. PSGs regulate T-cell function. The regulation of T-cell function during pregnancy is likely the result of significant hormonal changes and may well involve immunoregulatory proteins derived from the placenta. Pregnancy specific glycoproteins (PSGs) are the most abundant placentally derived glycoproteins in the maternal serum. PSG1, PSG6, PSG6N, and PSG11 induce dose-dependent secretion of anti-inflammatory cytokines by human monocytes. Human and murine PSGs exhibit cross-species activity.
References
  • Teglund S, et al. (1995) Characterization of cDNA encoding novel pregnancy-specific glycoprotein variants. Biochem Biophys Res Commun. 211(2):656-64.
  • Grimwood J, et al.. (2004) The DNA sequence and biology of human chromosome 19. Nature. 428(6982):529-35.
  • Gerhard DS, et al. (2004) The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). Genome Res. 14(10B):2121-7.
  • TOP