Rat Prealbumin/Transthyretin Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Gene

Species

Rat

NCBI Ref Seq

AF479660.1

RefSeq ORF Size

444bp

Gene Synonym

Lr1, Tbpa

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat transthyretin Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Prealbumin/Transthyretin, also known as ATTR, Prealbumin, TTR and PALB, is a secreted and cytoplasm protein which belongs to the Prealbumin / Transthyretin family. Prealbumin / Transthyretin is detected in serum and cerebrospinal fluid (at protein level). It is highly expressed in choroid plexus epithelial cells. It is also detected in retina pigment epithelium and liver. Each monomer of Prealbumin / Transthyretin has two 4-stranded beta sheets and the shape of a prolate ellipsoid. Antiparallel beta-sheet interactions link monomers into dimers. A short loop from each monomer forms the main dimer-dimer interaction. These two pairs of loops separate the opposed, convex beta-sheets of the dimers to form an internal channel. Prealbumin/Transthyretin is a carrier protein. It transports thyroid hormones in the plasma and cerebrospinal fluid, and also transports retinol (vitamin A) in the plasma. Defects in Prealbumin / Transthyretin are the cause of amyloidosis type 1 (AMYL1) which is a hereditary generalized amyloidosis due to Prealbumin / Transthyretin amyloid deposition. Protein fibrils can form in different tissues leading to amyloid polyneuropathies, amyloidotic cardiomyopathy, carpal tunnel syndrome, systemic senile amyloidosis. The diseases caused by mutations include amyloidotic polyneuropathy, euthyroid hyperthyroxinaemia, amyloidotic vitreous opacities, cardiomyopathy, oculoleptomeningeal amyloidosis, meningocerebrovascular amyloidosis, carpal tunnel syndrome, etc.

References

Westermark P, et al. (1990) Fibril in senile systemic amyloidosis is derived from normal transthyretin. Proc Natl Acad Sci U S A. 87(7): 2843-5.

Colon W, et al. (1992) Partial denaturation of transthyretin is sufficient for amyloid fibril formation in vitro. Biochemistry. 31(36): 8654-60.

Hammarstrm P, et al. (2003) Prevention of transthyretin amyloid disease by changing protein misfolding energetics. Science. 299(5607): 713-6.

Catalog Number:HGG087-NF