Rat Prealbumin/Transthyretin Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Rat

NCBI Ref Seq

AF479660.1

RefSeq ORF Size

444bp

Gene Synonym

Lr1, Tbpa

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat transthyretin Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Prealbumin/Transthyretin, also known as ATTR, Prealbumin, TTR and PALB, is a secreted and cytoplasm protein which belongs to the Prealbumin / Transthyretin family. Prealbumin / Transthyretin is detected in serum and cerebrospinal fluid (at protein level). It is highly expressed in choroid plexus epithelial cells. It is also detected in retina pigment epithelium and liver. Each monomer of Prealbumin / Transthyretin has two 4-stranded beta sheets and the shape of a prolate ellipsoid. Antiparallel beta-sheet interactions link monomers into dimers. A short loop from each monomer forms the main dimer-dimer interaction. These two pairs of loops separate the opposed, convex beta-sheets of the dimers to form an internal channel. Prealbumin/Transthyretin is a carrier protein. It transports thyroid hormones in the plasma and cerebrospinal fluid, and also transports retinol (vitamin A) in the plasma. Defects in Prealbumin / Transthyretin are the cause of amyloidosis type 1 (AMYL1) which is a hereditary generalized amyloidosis due to Prealbumin / Transthyretin amyloid deposition. Protein fibrils can form in different tissues leading to amyloid polyneuropathies, amyloidotic cardiomyopathy, carpal tunnel syndrome, systemic senile amyloidosis. The diseases caused by mutations include amyloidotic polyneuropathy, euthyroid hyperthyroxinaemia, amyloidotic vitreous opacities, cardiomyopathy, oculoleptomeningeal amyloidosis, meningocerebrovascular amyloidosis, carpal tunnel syndrome, etc.

References

Westermark P, et al. (1990) Fibril in senile systemic amyloidosis is derived from normal transthyretin. Proc Natl Acad Sci U S A. 87(7): 2843-5.

Colon W, et al. (1992) Partial denaturation of transthyretin is sufficient for amyloid fibril formation in vitro. Biochemistry. 31(36): 8654-60.

Hammarstrm P, et al. (2003) Prevention of transthyretin amyloid disease by changing protein misfolding energetics. Science. 299(5607): 713-6.

Catalog Number:HGG087-CM