Human PPP3R1 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:HGG062-CM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
513bp
Gene Synonym
CNB, CNB1, CALNB1, PPP3R1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human protein phosphatase 3, regulatory subunit B, alpha Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
PPP3R1 belongs to the calcineurin regulatory subunit family. It is a regulatory subunit of calcineurin. Calcineurin is composed of two subunits: calcineurin A (CnA) and calcineurin B (CnB). Dephosphorylation of the nuclear factor of activated T-cells (NF-AT) by Calcineurin is essential for NF-AT activation, nuclear translocation, and early gene expression in T-cells. PPP3R1 is a Ser/Thr-specific calcium and calmodulin-dependent protein phosphatase which takes a vital part in the T cell activation pathway. PPP3R1 is involved in protein dephosphorylation, NFAT protein import into nucleus (ortholog) and epithelial to mesenchymal transition (ortholog). It participates in calcineurin signaling pathway; mitogen activated protein kinase signaling pathway. PPP3R1 interacts with (+)-pilocarpine, 2,4-dinitrotoluene and ammonium chloride. It contains four EF-hand domains and four functional calcium-binding sites. PPP3R1 play an improtant role in the T cell activation pathway.
References
  • Feng B, et al. (1999) Interactions of calcineurin A, calcineurin B, and Ca2+. Biochemistry 38 (38): 12481-9.
  • Kawamura A, et al. (1995) Interaction of FKBP12-FK506 with calcineurin A at the B subunit-binding domain. J Biol Chem. 270(26):15463-6.
  • Wang MG, et al. (1997) Calcineurin A alpha (PPP3CA), calcineurin A beta (PPP3CB) and calcineurin B (PPP3R1) are located on human chromosomes 4, 10q21q22 and 2p16p15 respectively. Cytogenet Cell Genet. 72(2-3):236-41.
  • TOP