Human PPP3R1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:HGG062-CF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
513bp
Gene Synonym
CNB, CNB1, CALNB1, PPP3R1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human protein phosphatase 3, regulatory subunit B, alpha Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
PPP3R1 belongs to the calcineurin regulatory subunit family. It is a regulatory subunit of calcineurin. Calcineurin is composed of two subunits: calcineurin A (CnA) and calcineurin B (CnB). Dephosphorylation of the nuclear factor of activated T-cells (NF-AT) by Calcineurin is essential for NF-AT activation, nuclear translocation, and early gene expression in T-cells. PPP3R1 is a Ser/Thr-specific calcium and calmodulin-dependent protein phosphatase which takes a vital part in the T cell activation pathway. PPP3R1 is involved in protein dephosphorylation, NFAT protein import into nucleus (ortholog) and epithelial to mesenchymal transition (ortholog). It participates in calcineurin signaling pathway; mitogen activated protein kinase signaling pathway. PPP3R1 interacts with (+)-pilocarpine, 2,4-dinitrotoluene and ammonium chloride. It contains four EF-hand domains and four functional calcium-binding sites. PPP3R1 play an improtant role in the T cell activation pathway.
References
  • Feng B, et al. (1999) Interactions of calcineurin A, calcineurin B, and Ca2+. Biochemistry 38 (38): 12481-9.
  • Kawamura A, et al. (1995) Interaction of FKBP12-FK506 with calcineurin A at the B subunit-binding domain. J Biol Chem. 270(26):15463-6.
  • Wang MG, et al. (1997) Calcineurin A alpha (PPP3CA), calcineurin A beta (PPP3CB) and calcineurin B (PPP3R1) are located on human chromosomes 4, 10q21q22 and 2p16p15 respectively. Cytogenet Cell Genet. 72(2-3):236-41.
  • TOP