Human PLTP transcript variant 1 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:HGF935-NO

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1482bp
Gene Synonym
HDLCQ9, PLTP
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human phospholipid transfer protein, transcript variant 1 Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Phospholipid transfer protein, also known as Lipid transfer protein II and PLTP, is a secreted protein which belongs to the BPI/LBP/Plunc superfamily and BPI / LBP family. PLTP is nearly ubiquitously expressed in cells and tissues. PLTP converts HDL into larger and smaller particles. It may play a key role in extracellular phospholipid transport and modulation of hdl particles. High-density lipoproteins (HDL) play a major protective role against the development of coronary artery disease. PLTP is a main factor regulating the size and composition of HDL in the circulation and plays an important role in controlling plasma HDL levels. This is achieved via both the phospholipid transfer activity of PLTP and its capability to cause HDL conversion. PLTP is one of the key lipid transfer proteins in plasma and cerebrospinal fluid. It is involved in novel intracellular functions. PLTP is an important modulator of lipoprotein metabolism, including interparticle phospholipid transfer, remodeling of HDL, cholesterol and phospholipid efflux from peripheral tissues, and the production of hepatic VLDL. PLTP also plays an important role in inflammation and oxidative stress. Accordingly, PLTP has also been implicated in the development of atherosclerosis.
References
  • Huuskonen, J. et al., 2000, Atherosclerosis. 151 (2): 451-61.
  • Huuskonen,J. et al., 2001, Atherosclerosis. 155 (2): 269-81.
  • Valenta,D.T. et al., 2008, J Lipid Res. 49 (1): 24-32.
  • Vuletic,S. et al., 2009, Biochim Biophys Acta. 1793 (3): 584-91.
  • Chen, X. et al., 2009, Nutr Metab. 6 : 49.
  • TOP