Human PLTP transcript variant 1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Human

NCBI Ref Seq

NM_006227.2

RefSeq ORF Size

1482bp

Gene Synonym

HDLCQ9, PLTP

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human phospholipid transfer protein, transcript variant 1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Phospholipid transfer protein, also known as Lipid transfer protein II and PLTP, is a secreted protein which belongs to the BPI/LBP/Plunc superfamily and BPI / LBP family. PLTP is nearly ubiquitously expressed in cells and tissues. PLTP converts HDL into larger and smaller particles. It may play a key role in extracellular phospholipid transport and modulation of hdl particles. High-density lipoproteins (HDL) play a major protective role against the development of coronary artery disease. PLTP is a main factor regulating the size and composition of HDL in the circulation and plays an important role in controlling plasma HDL levels. This is achieved via both the phospholipid transfer activity of PLTP and its capability to cause HDL conversion. PLTP is one of the key lipid transfer proteins in plasma and cerebrospinal fluid. It is involved in novel intracellular functions. PLTP is an important modulator of lipoprotein metabolism, including interparticle phospholipid transfer, remodeling of HDL, cholesterol and phospholipid efflux from peripheral tissues, and the production of hepatic VLDL. PLTP also plays an important role in inflammation and oxidative stress. Accordingly, PLTP has also been implicated in the development of atherosclerosis.

References

Huuskonen, J. et al., 2000, Atherosclerosis. 151 (2): 451-61.

Huuskonen,J. et al., 2001, Atherosclerosis. 155 (2): 269-81.

Valenta,D.T. et al., 2008, J Lipid Res. 49 (1): 24-32.

Vuletic,S. et al., 2009, Biochim Biophys Acta. 1793 (3): 584-91.

Chen, X. et al., 2009, Nutr Metab. 6 : 49.

Catalog Number:HGF935-CF