Human PHPT1 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Catalog Number:HGF826-CO

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
378bp
Gene Synonym
PHPT1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human phosphohistidine phosphatase 1 Gene ORF cDNA clone expression plasmid,C terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
PHPT1, also known as 14 kDa phosphohistidine phosphatase, phosphohistidine phosphatase 1, protein janus-A homolog, PHP14, is a cytoplasm protein which belongs to the janus family. PHPT1 / PHP14 is expressed abundantly in heart and skeletal muscle. Phosphatases are a diverse group of enzymes that regulate numerous cellular processes. Much of what is known relates to the tyrosine, threonine, and serine phosphatases, whereas the histidine phosphatases have not been studied as much. Protein histidine phosphorylation exists widely in vertebrates, and it plays important roles in signal transduction and other cellular functions. Protein histidine phosphorylation accounts for about 6% of the total protein phosphorylation in eukaryotic cells. The knowledge about eukaryotic PHPT (protein histidine phosphatase) is still very limited. To date, only one vertebrate PHPT has been discovered, and two crystal structures of human PHPT1 have been solved. PHPT1 / PHP14 can dephosphorylate a variety of proteins (e.g. ATP-citrate lyase and the beta-subunit of G proteins). A putative active site has been identified by its electrostatic character, ion binding, and conserved protein residues.
References
  • Busam,R.D. et al., 2006, J Biol Chem. 281 (45):33830-4.
  • Zhang,X.Q. et al., 2009, Ups J Med Sci.114 (2):65-72.
  • Gong,W. et al., 2009, Biochem J. 418 (2):337-44.
  • Chapin,L.J. et al., 2009, J Exp Bot. 60 (7):2179-90.
  • TOP