Human PHPT1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:HGF826-CF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
378bp
Gene Synonym
PHPT1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human phosphohistidine phosphatase 1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
PHPT1, also known as 14 kDa phosphohistidine phosphatase, phosphohistidine phosphatase 1, protein janus-A homolog, PHP14, is a cytoplasm protein which belongs to the janus family. PHPT1 / PHP14 is expressed abundantly in heart and skeletal muscle. Phosphatases are a diverse group of enzymes that regulate numerous cellular processes. Much of what is known relates to the tyrosine, threonine, and serine phosphatases, whereas the histidine phosphatases have not been studied as much. Protein histidine phosphorylation exists widely in vertebrates, and it plays important roles in signal transduction and other cellular functions. Protein histidine phosphorylation accounts for about 6% of the total protein phosphorylation in eukaryotic cells. The knowledge about eukaryotic PHPT (protein histidine phosphatase) is still very limited. To date, only one vertebrate PHPT has been discovered, and two crystal structures of human PHPT1 have been solved. PHPT1 / PHP14 can dephosphorylate a variety of proteins (e.g. ATP-citrate lyase and the beta-subunit of G proteins). A putative active site has been identified by its electrostatic character, ion binding, and conserved protein residues.
References
  • Busam,R.D. et al., 2006, J Biol Chem. 281 (45):33830-4.
  • Zhang,X.Q. et al., 2009, Ups J Med Sci.114 (2):65-72.
  • Gong,W. et al., 2009, Biochem J. 418 (2):337-44.
  • Chapin,L.J. et al., 2009, J Exp Bot. 60 (7):2179-90.
  • TOP