Human PCSK9/NARC1 ORF mammalian expression plasmid, N-His tag Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:HGF679-NO

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2082 bp
Gene Synonym
FH3,HCHOLA3,LDLCQ1,NARC-1,NARC1,PC9
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human proprotein convertase subtilisin/kexin type 9 Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
HindIII + XbaI(6kb+2.08kb)
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Proprotein convertase subtilisin/kexin type 9 (PCSK9), also known as NARC1 (neural apoptosis regulated convertase), which is a newly identified human secretory subtilase belonging to the proteinase K subfamily of the secretory subtilase family. PCSK9 protein is an enzyme which in humans is encoded by the PCSK9 gene with orthologs found across many species. It is expressed in neuroepithelioma, colon carcinoma, hepatic and pancreatic cell lines, and in Schwann cells. PCSK9 protein is highly expressed in the liver and regulates low density lipoprotein receptor (LDLR) protein levels. Inhibition of PCSK9 protein function is currently being explored as a means of lowering cholesterol levels. Thereby, PCSK9 protein is regarded as a new strategy to treat hypercholesterolemia. PCSK9 protein contributes to cholesterol homeostasis and may have a role in the differentiation of cortical neurons.
References
  • Sseidah, N.G. et al., 2003, Proc. Natl. Acad. Sci. USA. 100: 928-933.
  • Beyer, T.P. et al., 2007, J. Lipid. Res. 48: 1488-1498
  • Shan, L. et al., 2008, Biochem. Biophys. Res. Commun. 375: 69-73.
  • Benjannet, S. et al., 2005, J. Biol. Chem. 279: 48865-48875.
  • Abifadel, M. et al., 2003, Nat. Genet. 34: 154-156.
  • TOP