Human PCSK9/NARC1 ORF mammalian expression plasmid, N-His tag Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:HGF679-NM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2082 bp
Gene Synonym
FH3,HCHOLA3,LDLCQ1,NARC-1,NARC1,PC9
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human proprotein convertase subtilisin/kexin type 9 Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
HindIII + XbaI(6kb+2.08kb)
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Proprotein convertase subtilisin/kexin type 9 (PCSK9), also known as NARC1 (neural apoptosis regulated convertase), which is a newly identified human secretory subtilase belonging to the proteinase K subfamily of the secretory subtilase family. PCSK9 protein is an enzyme which in humans is encoded by the PCSK9 gene with orthologs found across many species. It is expressed in neuroepithelioma, colon carcinoma, hepatic and pancreatic cell lines, and in Schwann cells. PCSK9 protein is highly expressed in the liver and regulates low density lipoprotein receptor (LDLR) protein levels. Inhibition of PCSK9 protein function is currently being explored as a means of lowering cholesterol levels. Thereby, PCSK9 protein is regarded as a new strategy to treat hypercholesterolemia. PCSK9 protein contributes to cholesterol homeostasis and may have a role in the differentiation of cortical neurons.
References
  • Sseidah, N.G. et al., 2003, Proc. Natl. Acad. Sci. USA. 100: 928-933.
  • Beyer, T.P. et al., 2007, J. Lipid. Res. 48: 1488-1498
  • Shan, L. et al., 2008, Biochem. Biophys. Res. Commun. 375: 69-73.
  • Benjannet, S. et al., 2005, J. Biol. Chem. 279: 48865-48875.
  • Abifadel, M. et al., 2003, Nat. Genet. 34: 154-156.
  • TOP