Mouse PARP-1/PARP Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:HGF622-CY

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
3045bp
Gene Synonym
PARP, PPOL, Adprp, Adprt1, C80510, parp-1, sPARP-1, AI893648, 5830444G22Rik, Parp1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse poly (ADP-ribose) polymerase family, member 1 Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Poly (ADP-ribose) polymerase 1(PRAP1), also known as NAD(+) ADP-ribosyltransferase 1(ADPRT), is a chromatin-associated enzyme which modifies various nuclear proteins by poly(ADP-ribosyl)ation. The ADP-D-ribosyl group of NAD+ is transferred to an acceptor carboxyl group on a histone or the enzyme itself, and further ADP-ribosyl groups are transferred to the 2'-position of the terminal adenosine moiety, building up a polymer with an average chain length of 20-30 units. The poly(ADP-ribosyl)ation modification is critical for a wide range of processes, including DNA repair, regulation of chromosome structure, transcriptional regulation, mitosis and apoptosis. PARP1 is demonstrateed to mediate the poly(ADP-ribose) ation of APLF (aprataxin PNK-like factor) and CHFR (checkpoint protein with FHA and RING domains), two representative proteins involved in the DNA damage response and checkpoint regulation. Further, It has been suggested that DNA-dependent protein kinase (DNA-PK), another component of DNA repair, suppresses PARP activity, probably through direct binding and/or sequestration of DNA-ends which serve as an important stimulator for both enzymes. PARP1 inhibitors is thus proposed as a targeted cancer therapy for recombination deficient cancers, such as BRCA2 tumors.
References
  • Malanga M. et al., 1998, J Biol Chem. 273: 11839-11843.
  • Ariumi Y. et al., 1999, Oncogene. 18: 4616-4625.
  • Helleday T. et al., 2005, Cell Cycle. 4: 1176-1178.
  • Ahell I. et al., 2008, Nature. 451: 81-85.
  • TOP