Mouse PARP-1/PARP Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Mouse

NCBI Ref Seq

NM_007415.2

RefSeq ORF Size

3045bp

Gene Synonym

PARP, PPOL, Adprp, Adprt1, C80510, parp-1, sPARP-1, AI893648, 5830444G22Rik, Parp1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse poly (ADP-ribose) polymerase family, member 1 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Poly (ADP-ribose) polymerase 1(PRAP1), also known as NAD(+) ADP-ribosyltransferase 1(ADPRT), is a chromatin-associated enzyme which modifies various nuclear proteins by poly(ADP-ribosyl)ation. The ADP-D-ribosyl group of NAD+ is transferred to an acceptor carboxyl group on a histone or the enzyme itself, and further ADP-ribosyl groups are transferred to the 2'-position of the terminal adenosine moiety, building up a polymer with an average chain length of 20-30 units. The poly(ADP-ribosyl)ation modification is critical for a wide range of processes, including DNA repair, regulation of chromosome structure, transcriptional regulation, mitosis and apoptosis. PARP1 is demonstrateed to mediate the poly(ADP-ribose) ation of APLF (aprataxin PNK-like factor) and CHFR (checkpoint protein with FHA and RING domains), two representative proteins involved in the DNA damage response and checkpoint regulation. Further, It has been suggested that DNA-dependent protein kinase (DNA-PK), another component of DNA repair, suppresses PARP activity, probably through direct binding and/or sequestration of DNA-ends which serve as an important stimulator for both enzymes. PARP1 inhibitors is thus proposed as a targeted cancer therapy for recombination deficient cancers, such as BRCA2 tumors.

References

Malanga M. et al., 1998, J Biol Chem. 273: 11839-11843.

Ariumi Y. et al., 1999, Oncogene. 18: 4616-4625.

Helleday T. et al., 2005, Cell Cycle. 4: 1176-1178.

Ahell I. et al., 2008, Nature. 451: 81-85.

Catalog Number:HGF622-CM