Mouse OTUB1 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:HGF546-NO

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
816bp
Gene Synonym
AI850305
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse OTU domain, ubiquitin aldehyde binding 1 Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Ubiquitin thioesterase OTUB1, also known as Deubiquitinating enzyme OTUB1, OTU domain-containing ubiquitin aldehyde-binding protein 1, Otubain-1, Ubiquitin-specific-processing protease OTUB1, OTUB1 and OTB1, is a cytoplasm protein which belongs to the peptidase C65 family. OTUB1 is a hydrolase that can remove conjugated ubiquitin from proteins and plays an important regulatory role at the level of protein turnover by preventing degradation. OTUB1 is a regulator of T-cell anergy, a phenomenon that occurs when T-cells are rendered unresponsive to antigen rechallenge and no longer respond to their cognate antigen. OTUB1 acts via its interaction with RNF128 / GRAIL, a crucial inductor of CD4 T-cell anergy. Isoform 1 of OTUB1 destabilizes RNF128, leading to prevent anergy. In contrast, isoform 2 of OTUB1 stabilizes RNF128 and promotes anergy. OTUB1 regulates RNF128-mediated ubiquitination, but does not deubiquitinate polyubiquitinated RNF128. Deubiquitinates estrogen receptor alpha (ESR1). OTUB1 mediates deubiquitination of 'Lys-48'-linked polyubiquitin chains, but not 'Lys-63'-linked polyubiquitin chains. OTUB1 is also capable of removing NEDD8 from NEDD8 conjugates, but with a much lower preference compared to 'Lys-48'-linked ubiquitin.
References
  • Balakirev M.Y., et al., 2003, EMBO Rep. 4:517-522.
  • Soares L., et al., 2004, Nat. Immunol. 5:45-54.
  • Stanisic V., et al., 2009, J. Biol. Chem. 284:16135-16145.
  • Choudhary C., et al., 2009, Science 325:834-840.
  • Edelmann M.J., et al., 2009, Biochem. J. 418:379-390.
  • TOP