Mouse OTUB1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:HGF546-CF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
816bp
Gene Synonym
AI850305
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse OTU domain, ubiquitin aldehyde binding 1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Ubiquitin thioesterase OTUB1, also known as Deubiquitinating enzyme OTUB1, OTU domain-containing ubiquitin aldehyde-binding protein 1, Otubain-1, Ubiquitin-specific-processing protease OTUB1, OTUB1 and OTB1, is a cytoplasm protein which belongs to the peptidase C65 family. OTUB1 is a hydrolase that can remove conjugated ubiquitin from proteins and plays an important regulatory role at the level of protein turnover by preventing degradation. OTUB1 is a regulator of T-cell anergy, a phenomenon that occurs when T-cells are rendered unresponsive to antigen rechallenge and no longer respond to their cognate antigen. OTUB1 acts via its interaction with RNF128 / GRAIL, a crucial inductor of CD4 T-cell anergy. Isoform 1 of OTUB1 destabilizes RNF128, leading to prevent anergy. In contrast, isoform 2 of OTUB1 stabilizes RNF128 and promotes anergy. OTUB1 regulates RNF128-mediated ubiquitination, but does not deubiquitinate polyubiquitinated RNF128. Deubiquitinates estrogen receptor alpha (ESR1). OTUB1 mediates deubiquitination of 'Lys-48'-linked polyubiquitin chains, but not 'Lys-63'-linked polyubiquitin chains. OTUB1 is also capable of removing NEDD8 from NEDD8 conjugates, but with a much lower preference compared to 'Lys-48'-linked ubiquitin.
References
  • Balakirev M.Y., et al., 2003, EMBO Rep. 4:517-522.
  • Soares L., et al., 2004, Nat. Immunol. 5:45-54.
  • Stanisic V., et al., 2009, J. Biol. Chem. 284:16135-16145.
  • Choudhary C., et al., 2009, Science 325:834-840.
  • Edelmann M.J., et al., 2009, Biochem. J. 418:379-390.
  • TOP