Mouse NQO1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:HGF362-NF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
825bp
Gene Synonym
AV001255,Dia4,Dtd,Nmo-1,Nmo1,Nmor1,Ox-1,Ox1,Qr1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse NAD(P)H dehydrogenase, quinone 1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
NQO1 gene is a member of the NAD(P)H dehydrogenase (quinone) family and encodes a cytoplasmic 2-electron reductase. NQO1 forms homodimers and reduces quinones to hydroquinones. NQO1's enzymatic activity prevents the one electron reduction of quinones that results in the production of radical species. Mutations in NQO1 gene have been associated with tardive dyskinesia (TD), an increased risk of hematotoxicity after exposure to benzene, and susceptibility to various forms of cancer. Altered expression of NQO1 has been seen in many tumors and is also associated with Alzheimer's disease (AD). Alternate transcriptional splice variants, encoding different isoforms, have been characterized. Recent pharmacological research suggests feasibility of genotype-directed redox chemotherapeutic intervention targeting NQO1 breast cancer, a common missense genotype encoding a functionally impaired NQO1 protein.
References
  • Ross David. et al., 2002, J Biol Chem. 277 (16): 14060-7.
  • Cabello CM. et al., 2010, Free Radic Res. 45 (3): 276-92.
  • Adesnik M. et al., 1988, J Biol Chem. 263 (27): 13572-8.
  • TOP