Mouse NQO1 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:HGF362-CM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
825bp
Gene Synonym
AV001255,Dia4,Dtd,Nmo-1,Nmo1,Nmor1,Ox-1,Ox1,Qr1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse NAD(P)H dehydrogenase, quinone 1 Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
NQO1 gene is a member of the NAD(P)H dehydrogenase (quinone) family and encodes a cytoplasmic 2-electron reductase. NQO1 forms homodimers and reduces quinones to hydroquinones. NQO1's enzymatic activity prevents the one electron reduction of quinones that results in the production of radical species. Mutations in NQO1 gene have been associated with tardive dyskinesia (TD), an increased risk of hematotoxicity after exposure to benzene, and susceptibility to various forms of cancer. Altered expression of NQO1 has been seen in many tumors and is also associated with Alzheimer's disease (AD). Alternate transcriptional splice variants, encoding different isoforms, have been characterized. Recent pharmacological research suggests feasibility of genotype-directed redox chemotherapeutic intervention targeting NQO1 breast cancer, a common missense genotype encoding a functionally impaired NQO1 protein.
References
  • Ross David. et al., 2002, J Biol Chem. 277 (16): 14060-7.
  • Cabello CM. et al., 2010, Free Radic Res. 45 (3): 276-92.
  • Adesnik M. et al., 1988, J Biol Chem. 263 (27): 13572-8.
  • TOP