Human Neuroligin 1/NLGN1 Gene ORF cDNA clone expression plasmid,N terminal His tag

Catalog Number:HGF245-NH

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2472bp
Gene Synonym
KIAA1070, MGC45115, NLGN1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human neuroligin 1 Gene ORF cDNA clone expression plasmid,N terminal His tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-His
Restriction Site
Protein Tag
His
Tag Sequence
CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
His Tag Information

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Neuroligin 1 (NLGN1) belongs to the type-B carboxylesterase/lipase family, is a synaptic cell-adhesion molecule that is enriched in postsynaptic densities where it may recruit receptors, channels, and signal-transduction molecules to synaptic sites of cell adhesion. Neuroligins consist of five members (NLGN1, NLGN2, NLGN3, NLGN4 and NLGN4Y), which interact with beta-neurexins and this interaction is involved in the formation of functional synapses. The extracellular domain of functional Neuroligin 1 associates as a dimer when analyzed by sedimentation equilibrium. Neuroligin 1 has a unique N-linked glycosylation pattern in the neuroligin family, and glycosylation and its processing modify neuroligin activity. Neuroligin 1 is a potent trigger for the de novo formation of synaptic connections, and it has recently been suggested that it is required for the maturation of functionally competent excitatory synapses. The persistent expression of Neuroligin 1 is required for the maintenance of NMDAR-mediated synaptic transmission, which enables normal development of synaptic plasticity and long-term memory in the amygdala of adult animals.
References
  • Song JY, et al. (1999) Neuroligin 1 is a postsynaptic cell-adhesion molecule of excitatory synapses. Proc Natl Acad Sci U S A. 96(3): 1100-5.
  • Comoletti D, et al. (2003) Characterization of the interaction of a recombinant soluble neuroligin-1 with neurexin-1beta. J Biol Chem. 278(50): 50497-505.
  • Ylisaukko-oja T, et al. (2005) Analysis of four neuroligin genes as candidates for autism. Eur J Hum Genet. 13(12): 1285-92.
  • Kim J, et al. (2008) Neuroligin-1 is required for normal expression of LTP and associative fear memory in the amygdala of adult animals. Proc Natl Acad Sci U S A. 105(26): 9087-92.
  • Schapitz IU, et al. (2010) Neuroligin 1 is dynamically exchanged at postsynaptic sites. J Neurosci. 30(38): 12733-44.
  • TOP