Human Neuroligin 1/NLGN1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Human

NCBI Ref Seq

NM_014932.2

RefSeq ORF Size

2472bp

Gene Synonym

KIAA1070, MGC45115, NLGN1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human neuroligin 1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Neuroligin 1 (NLGN1) belongs to the type-B carboxylesterase/lipase family, is a synaptic cell-adhesion molecule that is enriched in postsynaptic densities where it may recruit receptors, channels, and signal-transduction molecules to synaptic sites of cell adhesion. Neuroligins consist of five members (NLGN1, NLGN2, NLGN3, NLGN4 and NLGN4Y), which interact with beta-neurexins and this interaction is involved in the formation of functional synapses. The extracellular domain of functional Neuroligin 1 associates as a dimer when analyzed by sedimentation equilibrium. Neuroligin 1 has a unique N-linked glycosylation pattern in the neuroligin family, and glycosylation and its processing modify neuroligin activity. Neuroligin 1 is a potent trigger for the de novo formation of synaptic connections, and it has recently been suggested that it is required for the maturation of functionally competent excitatory synapses. The persistent expression of Neuroligin 1 is required for the maintenance of NMDAR-mediated synaptic transmission, which enables normal development of synaptic plasticity and long-term memory in the amygdala of adult animals.

References

Song JY, et al. (1999) Neuroligin 1 is a postsynaptic cell-adhesion molecule of excitatory synapses. Proc Natl Acad Sci U S A. 96(3): 1100-5.

Comoletti D, et al. (2003) Characterization of the interaction of a recombinant soluble neuroligin-1 with neurexin-1beta. J Biol Chem. 278(50): 50497-505.

Ylisaukko-oja T, et al. (2005) Analysis of four neuroligin genes as candidates for autism. Eur J Hum Genet. 13(12): 1285-92.

Kim J, et al. (2008) Neuroligin-1 is required for normal expression of LTP and associative fear memory in the amygdala of adult animals. Proc Natl Acad Sci U S A. 105(26): 9087-92.

Schapitz IU, et al. (2010) Neuroligin 1 is dynamically exchanged at postsynaptic sites. J Neurosci. 30(38): 12733-44.

Catalog Number:HGF245-CF