Human NEK7 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Gene

Species

Human

NCBI Ref Seq

NM_133494.2

RefSeq ORF Size

909bp

Gene Synonym

NEK7

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human NIMA (never in mitosis gene a)-related kinase 7 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

NIMA (never in mitosis gene a)-related kinase 7, NEK7 belongs to the NIMA subfamily, NEK Ser/Thr protein kinase family, protein kinase superfamily. NEKs (NIMA-related kinases) are mammalian serine/threonine (Ser/Thr) protein kinases structurally related to Aspergillus NIMA (Never in Mitosis, gene A), which plays essential roles in mitotic signaling. NEKs share an amino-terminal catalytic domain related to NIMA, an Aspergillus kinase involved in the control of several aspects of mitosis, and divergent carboxyl-terminal tails of varying length. NEKs are commonly referred to as mitotic kinases, although a definitive in vivo verification of this definition is largely missing. Reduction in the activity of NEK7 or its close paralog, NEK6, has previously been shown to arrest cells in mitosis, mainly at metaphase. NEK7 is a regulator of cell division, and reveal it as an essential component for mammalian growth and survival. The intimate connection between tetraploidy, aneuploidy and cancer development suggests that NEK7 deregulation can induce oncogenesis. The endogenous NEK7 protein is enriched at the centrosome in a microtubule-independent manner. Overexpression of wt or kinase-defective NEK7 resulted in cells of rounder appearance, and higher proportions of multinuclear and apoptotic cells.

References

Belham C, et al. (2003) A mitotic cascade of NIMA family kinases. Nercc1/Nek9 activates the Nek6 and Nek7 kinases. J Biol Chem. 278(37): 34897-909.

Minoguchi S, et al.. (2003) Differential control of the NIMA-related kinases, Nek6 and Nek7, by serum stimulation. Biochem Biophys Res Commun. 301(4): 899-906.

Yissachar N, et al. (2006) Nek7 kinase is enriched at the centrosome, and is required for proper spindle assembly and mitotic progression. FEBS Lett. 580(27): 6489-95.

Salem H, et al. (2010) Nek7 kinase targeting leads to early mortality, cytokinesis disturbance and polyploidy. Oncogene. 29(28): 4046-57.

Catalog Number:HGF228-CO