Human NEK7 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:HGF228-CM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
909bp
Gene Synonym
NEK7
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human NIMA (never in mitosis gene a)-related kinase 7 Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
NIMA (never in mitosis gene a)-related kinase 7, NEK7 belongs to the NIMA subfamily, NEK Ser/Thr protein kinase family, protein kinase superfamily. NEKs (NIMA-related kinases) are mammalian serine/threonine (Ser/Thr) protein kinases structurally related to Aspergillus NIMA (Never in Mitosis, gene A), which plays essential roles in mitotic signaling. NEKs share an amino-terminal catalytic domain related to NIMA, an Aspergillus kinase involved in the control of several aspects of mitosis, and divergent carboxyl-terminal tails of varying length. NEKs are commonly referred to as mitotic kinases, although a definitive in vivo verification of this definition is largely missing. Reduction in the activity of NEK7 or its close paralog, NEK6, has previously been shown to arrest cells in mitosis, mainly at metaphase. NEK7 is a regulator of cell division, and reveal it as an essential component for mammalian growth and survival. The intimate connection between tetraploidy, aneuploidy and cancer development suggests that NEK7 deregulation can induce oncogenesis. The endogenous NEK7 protein is enriched at the centrosome in a microtubule-independent manner. Overexpression of wt or kinase-defective NEK7 resulted in cells of rounder appearance, and higher proportions of multinuclear and apoptotic cells.
References
  • Belham C, et al. (2003) A mitotic cascade of NIMA family kinases. Nercc1/Nek9 activates the Nek6 and Nek7 kinases. J Biol Chem. 278(37): 34897-909.
  • Minoguchi S, et al.. (2003) Differential control of the NIMA-related kinases, Nek6 and Nek7, by serum stimulation. Biochem Biophys Res Commun. 301(4): 899-906.
  • Yissachar N, et al. (2006) Nek7 kinase is enriched at the centrosome, and is required for proper spindle assembly and mitotic progression. FEBS Lett. 580(27): 6489-95.
  • Salem H, et al. (2010) Nek7 kinase targeting leads to early mortality, cytokinesis disturbance and polyploidy. Oncogene. 29(28): 4046-57.
  • TOP