Mouse MYC associated factor X Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:HGF086-NF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
456bp
Gene Synonym
bHLHd4; bHLHd5; bHLHd6; bHLHd7; bHLHd8; AA960152; AI875693
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse Max protein Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
MYC associated factor X contains 1 basic helix-loop-helix (bHLH) domain and belongs to MAX family. It is highly expressed in the brain, heart and lung while lower levels are seen in the liver, kidney and skeletal muscle. MYC associated factor X can form homodimers and heterodimers with other family members, which include Mad, Mxi1 and Myc. Myc is an oncoprotein implicated in cell proliferation, differentiation and apoptosis. The homodimers and heterodimers compete for a common DNA target site (the E box) and rearrangement among these dimer forms provides a complex system of transcriptional regulation. MYC associated factor X may also repress transcription via the recruitment of a chromatin remodeling complex containing H3 'Lys-9' histone methyltransferase activity. Multiple alternatively spliced transcript variants have been described for MYC associated factor X gene but the full-length nature for some of them is unknown.
References
  • Mac Partlin M, et al. (2003) Interactions of the DNA mismatch repair proteins MLH1 and MSH2 with c-MYC and MAX. Oncogene. 22(6):819-25.
  • Cheng SW, et al. (1999) c-MYC interacts with INI1/hSNF5 and requires the SWI/SNF complex for transactivation function. Nat enet. 22(1):102-5.
  • McMahon SB, et al. (1998) The novel ATM-related protein TRRAP is an essential cofactor for the c-Myc and E2F oncoproteins. Cell. 94(3):363-74.
  • TOP