Mouse MYC associated factor X Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:HGF086-CY

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
456bp
Gene Synonym
bHLHd4; bHLHd5; bHLHd6; bHLHd7; bHLHd8; AA960152; AI875693
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse Max protein Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
MYC associated factor X contains 1 basic helix-loop-helix (bHLH) domain and belongs to MAX family. It is highly expressed in the brain, heart and lung while lower levels are seen in the liver, kidney and skeletal muscle. MYC associated factor X can form homodimers and heterodimers with other family members, which include Mad, Mxi1 and Myc. Myc is an oncoprotein implicated in cell proliferation, differentiation and apoptosis. The homodimers and heterodimers compete for a common DNA target site (the E box) and rearrangement among these dimer forms provides a complex system of transcriptional regulation. MYC associated factor X may also repress transcription via the recruitment of a chromatin remodeling complex containing H3 'Lys-9' histone methyltransferase activity. Multiple alternatively spliced transcript variants have been described for MYC associated factor X gene but the full-length nature for some of them is unknown.
References
  • Mac Partlin M, et al. (2003) Interactions of the DNA mismatch repair proteins MLH1 and MSH2 with c-MYC and MAX. Oncogene. 22(6):819-25.
  • Cheng SW, et al. (1999) c-MYC interacts with INI1/hSNF5 and requires the SWI/SNF complex for transactivation function. Nat enet. 22(1):102-5.
  • McMahon SB, et al. (1998) The novel ATM-related protein TRRAP is an essential cofactor for the c-Myc and E2F oncoproteins. Cell. 94(3):363-74.
  • TOP